Friday, November 29, 2019

Ordinary Person free essay sample

As a young boy I lived in a typical suburban subdivision. It was a picturesque neighborhood with luscious green grass and blossoming flowers everywhere. Rows of uniform eggshell white houses aligned either side of the street. On the nice summer days, almost everyone played outside. Caleb, Kyle, Tony, Stacy, and Lindsey would be riding their bikes, playing tag, or using chalk to draw magnificent works of art all over the sidewalks. Meanwhile the chatter of adults could be heard in the background. All of this is going on while the aroma of cooking hamburgers floated throughout the neighborhood. Like many American kids, this was where I spent the majority of my childhood laughing and playing with friends. As a boy I did typical â€Å"boy† activities. I rode my bike, played cops and robbers, and even joined the occasional football or soccer game. Just like many other children across the country, life for me was average, except for the fact that my grandmother lived with me. We will write a custom essay sample on Ordinary Person or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page To someone unfamiliar, my life may have seemed similar to millions of others, however my childhood was unique. When I was still pretty young my grandma was diagnosed with cancer. This one experience changed my life. Although the doctors said she only had a few years to live at best, it didn’t make her give up hope. From this devastating situation, I learned to persevere and overcome any obstacle in my path. I remember when I was little, my grandma loved to take me on hikes through the forest preserve behind my house. She and I could walk for hours endlessly along the dirt path. During the walk, she would constantly point out different types of bugs, plants, and even trees to me, making me feel as if I was in a tropical rain forest, creating in me a love for the environment. From that moment on, I become fascinated with the environment. Soon I began tuning into the Discovery and Science channels on the television. Shows that discussed the future and new forms of producing power peaked my interest. However, my favorite thing to study was how energy can be captured in urban cities such as Chicago due to urban windmills and solar panel covered roofs. My grandma’s passion inspired me to pursue a degree in engineering. Today I still live in the same uniform eggshell white house on the same block that I did when I was younger. I still go to the park and play with my friends. The joyous laughter of children can still be heard every time I step outside my house and onto the Mona Lisa’s drawn on the sidewalk. Even the distinct smell of the cooking hamburgers still hovers over the neighborhood. However, today I see things in a different light. I no longer see my neighborhood from the perspective of a careless kid; I see it from the view of a concerned citizen. As I walk down the sidewalk, my mind is constantly thinking. I contemplate as I walk along the same streets as I did as a kid how I can help change peoples’ lives for the better. I wonder how much energy could be saved if all the street lights in my neighborhood alone were changed to LED lights. Sometimes I even wonder how much energy could be saved if all the street lights in the entire country ran on LED light bulbs. For me, these questions that some might not have even thought about for a second I have spent years thinking about. I believe that a neighborhood alone cannot define who a person is or how it shapes them; I think that it is more important to focus on whom in the neighborhood helped influence that person. Although I may have grown up in an ordinary town in a simple plain white house just like many other kids, the people who influenced me have drastically helped me grow up to be the young man I am today. Life is like a book, and being a kid is just the first of its many chapters. Childhood is the smallest part of one’s life, the chapter that most people seem to forget about when they are older. However I could never forget my chapter, because of the fact that its impact has influenced everything about me, who I am today, and who I will grow up to be in the future. I am unique. I stand out among the millions of other kids across the country because of the fact that my grandma has helped shape me more than my dull, run of the mill neighborhood ever could. Her philosophy of never giving up will carry on with me forever especially in my pursuit of earning an engineering degree.

Monday, November 25, 2019

Identification of Human Parechovirus in clinical samples Essays

Identification of Human Parechovirus in clinical samples Essays Identification of Human Parechovirus in clinical samples Essay Identification of Human Parechovirus in clinical samples Essay Introduction The viral genus Parechovirus belongs to the household of Picornaviridae which are non- enveloped, plus strand, RNA viruses. Human Parechovirus and Ljungan virus are the two species belong to this genus. The Ljungan viruses are virus of gnawers, were isolated from bank field mouses in Sweden from a patient infected with myocardial inflammation. It portions similarity with Human Parechoviruses. The Human Parechovirus consists of 14 genotypes: HPeV-1 to HPeV-14. The HPeV-1 undergoes recombination with other strains to bring forth the diverseness in Parechoviruses. The viruses are 7100 to 8500 bases long which are enclosed in an icosahedral mirid bug made up of 60 transcripts each of mirid bug proteins VP1 to VP4. Once the HPeV1 and HPeV2 were known as echovirus 22 and 23 severally. HPeV2 has 87.9 % aminoacid individuality with HPeV1 genotype. Both were foremost stray in1956 during an epidermic of summer diarrhea. The genome has four distant spheres. The 5 untranslated part ( UTR ) precedes a individual unfastened reading frame, towards downstream there is a 3untranslated part and a poly ( A ) tail. The genome encoding a individual protein is processed by many virus encoded enzymes which produces precursors that map in virus reproduction to bring forth protein eventually. Figure 1: The genome of Picorna virus with conventional representation of poly protein in Parecho virus. The peptide covalently bound to 5end. The perpendicular pointers indicate the virus encoded activities for processing proteins. The places of VP0, VP3 and VP1 are indicated as 0, 3, and 1 in the polyprotein severally ( Beginning: Stanway, G.et Al ( 1999 ) Parechoviruses.Journal of Virology, 73, 5249-5254 ) . In general, all Picorna viruses have same basic genomic organisation, but different genotypes show specific features in 5UTR construction, L and 2Aproteins and 3UTR. There exists similarity in 5UTR of Parechovirus with cardio, aphtho viruses which reflects recombinant events occurred in the development of parechoviruses. ( Stanway, G. et Al, ( 1998 ) Molecular analysis of human Parechovirus 2, Journal of General virology, 79,2641-2650 ) The Parechovirus shows assorted responses in host cells. The cleavage of mirid bug protein VP0 seen in other Picorna viruses are non found in Parechovirus. It has a alone extension at N-terminal of mirid bug protein, VP3 and 2A protein which is extremely basic in character. ( Stanway, G. et Al, ( 2000 ) Human parechoviruses- biological science and clinical significance, Reviews in Medical Virology,10,57-69. ) Many recent surveies shown that the Parechoviruses are holding high rate of pathogenicity which causes stomach flu, respiratory unwellness, feverish unwellness, skin eruption, manus, pes and oral cavity disease , sterile meningitis, herpangia. The more prevalence of Parechovirus infections are found in kids less than 3 old ages. Harmonizing to a research done by Miyabi Ito.et Al on clinical stool samples from a random population in Aichi, Japan suggests that the base and aminoacid sequence of Nipponese HPeV-3 was similar to that found in Canada and Netherlands. The survey confirms the world-wide prevalence of Human Parechovirus infection. Besides they concluded that 97 % of patients were younger than 3 old ages old, and among them 86.2 % were under 12 months old. The finding of nucleotide sequence and phyletic analysis of VP1 part and 5UTR part revealed that bulk were holding HPeV1 infection, so comes HPeV3, so HPeV4 and eventually less figure with HPeV6. They besides found some seasonal fluctuation act uponing the clinical manifestation of Parechovirus. HPeV1 detected preponderantly during autumn and winter while HPeV3 instances detected in summer and autumn. They came to a decision that there are differences in mechanism of pathogenesis between HPeV1 and HPeV3 infections. ( Miyabi Ito et Al ( 2010 ) Detection of Human Parecho virus in clinical stool samples in Aichi, Japan, Journal of Clinical Microbiology, 48, 2683-2688 ) Based on the survey of the antigenic belongingss of human Parechoviruses done by Paivi Joki Korpela. et Al, they identified the antigenic site is within VP0 polypeptide. In HPeV1 the antigenisity is in the C-terminal part. The immunological features of HPeV1 mirid bug protein was besides found out utilizing the peptide scanning techniques. ( Korpela, P.J et Al ( 2000 ) Antigenic belongingss of human parechovirus1, Journal of General Virology, 81, 1709-1718 ) Surveies reveal that HPeV infects the cardinal nervous system ( CNS ) in kids associated with terrible neonatal sepsis like unwellness, meningitis or palsy. A group of scientists under the counsel of S.Rangraj has done surveies on HPeV-CNS infection in United States. This was the first multiyear prevalence study of HPeV-CNS infection in United States. They have isolated nucleic acid from cerebrospinal fluid of kids around the Kansas City for 3 old ages 2006 to 2008. HPeV RT-PCR was used and surveies done by sequencing VP3/VP1 junction. They could observe the HPeV in 7 % cerebrospinal fluid samples taken from patients, and the sensing was seasonal from June to October. HPeV3-CNS infection was found in 71 % of male babies. Most common clinical symptoms were sepsis like unwellness ( 66 % ) , crossness ( 98 % ) , fever ( 95 % ) and non-specific roseolas ( 58.6 % ) . ( Rangaraj.S et al ( 2010 ) Human parechovirus3 doing sepsis like unwellness in kids from Midwestern United States, The Ped iatric Infections Disease Journal, www.journals.iww.com ) The prevalence of world-wide pathogenesis shown by Parechovirus is obviously proved by Pham et al by making the research in 362 fecal samples for the sensing of HPeV types in one twelvemonth 2005 to 2006. They have done the survey in many kids who got infected with stomach flu in Srilanka. Out of 362 samples, 30 were positive with HPeV ( 8.3 % ) .The genotypes isolated were HPeV1, 3,4,5,10,11. ( Pham.N.T.K et al ( 2010 ) Human Parechovirus infection in kids hospitalized with acute stomach flu in Srilanka, Journal of clinical microbiology, www.mdlinx.com ) . The viral RNA reproduction composite in HPeV1 septic cells would incorporate the viral protein and membrane changes. The structural alterations in virus septic cells include the Golgi setup decomposition and loss of ribosomes from endoplasmic Reticulum. The viral plus strand RNA and 2C viral proteins were found as bunchs of little cysts in cells. The membrane adhering belongingss of protein 2C resulted in the determination of its presence in Golgi setup and endoplasmic Reticulum. HPeV1 reproduction composite is formed by Golgi marker cysts forms a alone construction among other Picorna viruses. ( Krogerus.C et.al ( 2003 ) Replication composite of human Parechovirus 1, Journal of Virology, 77, 8512-8523 ) In this survey, the clinical sample from a kid with mild diarrhea is taken which is analysed utilizing assorted molecular techniques, in peculiar RT-PCR. The survey included the sensing and analysis of viral RNA, surmising it as HPeV by naming the particular symptoms shown by the patient. The RT-PCR is done by utilizing HPeV specific primers OL993A and OL994A. It is followed by sequencing DNA commercially in both orientations utilizing Gene service.T7 and SP6 RNA polymerase written text induction sites of pGEM ( R ) -T Easy vector is used for this intent. The Analysis of DNA sequence is done farther utilizing Bioinformatics tools. It offers a speedy method of observing Parechovirus and placing which of its genotype is present in the clinical sample. Materials and Methods All the molecular methods were done on the footing of protocol given in Stanway, G. ( 2009 ) Practical Handbook. The RNA being isolated from the clinical sample utilizing commercial kit, QIA A ( R ) viral RNA mini kit produced by Qiagen. The kit works on the rule of selective binding belongingss of silicon oxide gel. ( hypertext transfer protocol: //www1.qiagen.com/products/rnastabilizationpurification/cellviralrnapurificationsystems/qiaampviralrnaminikit.asp ) . The RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . Two primers OL993A and OL994A were used that are complimentary to the 3end of sense and anti sense strands of DNA, along with RT/PlatinumR Taq polymerase mix. The competent E.coli cells were transformed by utilizing the RT-PCR DNA and pGEM R-T Easy vector. The samples were spread to selective home bases incorporating Luria Bertani Broth. The plasmid DNA isolation was done with commercial kit, Qiagen QIA spin mini column and EcoR1 limitation digestion. The sample was so commercially sequenced utilizing Geneservice. The analysis of DNA sequence has been done with Blast plan ( hypertext transfer protocol: //www.ncbi.nlm.nih.gov/BLAST ) and alignment with Clustalw plan ( hypertext transfer protocol: //www.ebi.ac.uk/tools/clustalw/index.html ) . ( Stanway, G. ( 2009 ) BS934 Practical Handbook- Molecular Medicine Pathway ) Consequence Isolation of RNA from clinical sample: RNA set Deoxyribonucleic acid marker set Figure 2: The Agarose gel cataphoresis exposure of stray RNA sample. The RNA was isolated utilizing Qiagen viral RNA isolation kit. The cataphoresis was done along with DNA marker ( 1kb ladder supplied by Invitrogen ) and visualized the RNA set utilizing gel certification equipment. The RNA stuff was seen as a vilification on the Agarose gel. RT-PCR Deoxyribonucleic acid: Negative Control RT-PCR merchandise Deoxyribonucleic acid Marker Figure 3: The exposure of Ethidium bromide stained RT-PCR DNA after Agarose gel cataphoresis. As per the protocol given in Stanway, G. ( 2009 ) Practical Handbook, the RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . It is found out that the RT-PCR DNA set has been visualised utilizing gel certification equipment. The presence of set confirmed the presence of HPeV in the clinical sample. There was no set seen in the negative control demoing the echt consequence without any kind of taint. The approximative size of the merchandise is obtained by comparing with the 1kb size criterion DNA marker set. RT-PCR calibrated secret plan for finding the molecular weight of DNA sample: Distance migrated by unknown DNA sample= 37mm Figure 4: The graph between the molecular weight of DNA marker and the distance migrated in the gel cataphoresis. The unknown molecular weight of the RT-PCR sample is calculated from the graph ( fig: 4 ) which was migrated to a distance of 37mm was found to be about 1000 bp ( reverse log 3 ) . Final gel consequence: 1 2 3 4 Figure5: The Agarose gel exposure obtained in 2010 practical. In the fig: 5, the sets were obtained for the RT-PCR DNA and EcoR1cut DNA from white settlement ( Lane 2 and 4 severally ) . There was no set formed for the EcoR1 cut DNA from the blue settlement ( Lane 3 ) . Deoxyribonucleic acid marker RT-PCR Deoxyribonucleic acid from white settlement EcoR1 cut DNA from bluish settlement EcoR1 cut DNA from white settlement Figure 6: The Agarose gel exposure from 2009 practical for comparative survey. The set formed by EcoR1 cut DNA from bluish settlement can be seen. Multiple sequence alliance of DNA sample utilizing Clustalw plan: HPeV1 GAAGATGACACAGAAAATTGCAAACAAACAATGTC-TCCAAATGAACTAGGACTCACTTC 59 HPeV6 GAGGATGATGCTGAAAACTGTAAACAAACAATATC-CCCAAATGAATTGGGTTTAACGTC 59 Consensus -GAATCTGCAGAAGAATGTAAACAGACAATATCACCCAAATGAATTGGGATTAACATC 57 HPeV4 GATGATTGCACTGAAGATTGCAAACAGACTATTTC-CCCAGATGAACTGGGTCTAACTTC 59 HPeV5 GATGATGAAGCTGAGGATTGTAAACAAACTATATC-TCCTGATGAACTAGGTCTTACCTC 59 HPeV2 GAAGATTCAGTAGAAGATTGTAAGCAAACCATTAC-ACCAACAGAATTGGGACTAACCTC 59 HPeV7 GAGGATTGTACTGAGGATTGCAAACAATCTCTATC-CCCAGATGAATTGGGCCTCACATC 59 HPeV8 GAGGATAAAGTCGAAGAATGCAAACAGACATTGTC-CCCAAATGAACTAGGCTTGACATC 59 HPeV3 GAGGACAACATGGAAAATTGTAAACAGTCCATATC-ACCAAATGAATTGGGTTTGACTTC 59 ** ** * ** ** ** * * * ** *** * ** * ** ** HPeV1 AGCCCAAGATGATGGCCCACTTGGTCAAGAAAAGCCAAATTATTTTCTCAATTTTAGGTC 119 HPeV6 AGCACAGGATGATGGACCTCTAGGTGGGGAAAAACCAAATTACTTTCTAAATTTTAGAAC 119 Consensus AGCCCAGGATGATGGACCATTGGGCGATANCAAGCCAAATTATTTCCTAAATTTCAAGTC 117 HPeV4 AGCCCAAGACGATGGTCCTCTGGGAGGTGAAAAGCCAAATTACTTCTTGAATTTTAGAGC 119 HPeV5 AGCACAAGATGATGGGCCCCTTGGAGTAGAGAAACCAAATTATTTTCTAAATTTTAGAGC 119 HPeV2 AGCACAAGATGATGGCCCTTTAGGAAATGACAAACCAAATTATTTTCTTAACTTTAAGTC 119 HPeV7 AGCCCAAGATGATGGACCTCTCGGGTCCGAGAAACCAAATTATTTCTTAAATTTTAGGGC 119 HPeV8 CGCTCAAGATGATGGGCCACTTGGCAATGAAAAACCTAATTACTTCCTCAACTTTAAAGC 119 HPeV3 AGCTCAAGATGATGGGCCTTTGGGTAATGAGAAACCAAATTATTTTTTAAACTTCAGAAC 119 ** ** ** ***** ** * ** ** ** ***** ** * ** ** * * HPeV1 GATGAATGTGGACATTTTTACTGTATCACATACTAAAGTAGATAACCTATTTGGGCGGGC 179 HPeV6 TATGAATGTGGACATTTTCACGGTATCTCATACAAAAGTGGACAATATATTTGGTCGCGC 179 Consensus TATGAATGTAGACATCTTCACTGTTTCCCACACTAAGGTGGACAACTTATTTGGAAGAGC 177 HPeV4 TGTCAATGTTGACATATTTACTGTGAGTCACACTAAAGTAGACAACATCTTTGGTAGGGC 179 HPeV5 AATTAATGTAGATATCTTTACTGTTAGTCATACTAAGGTAGATAACATTTTTGGGCGTGC 179 HPeV2 TATGAATGTTGATATCTTTACTGTCAGTCACACCAAAGTAGACAATATTTTTGGACGTGC 179 HPeV7 AATGGATGTTGATATTTTCACCGCAAGCCACACTAAAGTAGATAACATTTTTGGGCGTGC 179 HPeV8 AATAAATGTGGATATTTTCACAGTGAGCCATACAAAAGTGGATAATATTTTTGGAAGGGC 179 HPeV3 TATGAATGTTGACATTTTTACAGTAAGTCATACCAAAGTTGACAACATCTTTGGTAGAGC 179 * **** ** ** ** ** * ** ** ** ** ** ** * ***** * ** HPeV1 ATGGTTTTTTATGGAGCATACTTTCACCAATGAGGGACAATGGAGAGTGCCATTGGAATT 239 HPeV6 CTGGTTTGTGACAAGCCATGATTTTAACAATGAGGGACAATGGCCCTTAAATTTGACTTT 239 Consensus ATGGTTCTACCAGGAACACACTTTTACAGACGAAGGACAGTGGAGAGTTAATTTGGAGTT 237 HPeV4 ATGGTTTGCATATGATCATACATATAGAGATGAAGGAACCTGGAGGCAGGCTTTGGATTT 239 HPeV5 ATGGTTGGCCCTTGAACACACATTTGCAGATGATGGAACATGGAGGGCAGATTTGAATTT 239 HPeV2 TTGGTTTGCCCATGTTCATGACTTCACTAATGATGGCCTATGGAGACAGGGATTGGAATT 239 HPeV7 CTGGTACAACTCACGGCATGAATTCACAAATGGTGATCTGTGGCGTAGTTCATTGACTTT 239 HPeV8 ATGGTATTCTATGGCTCATGAATTTAGAAATGAAGGTTTGTGGAGGACTAAACTTACTTT 239 HPeV3 TTGGTATGTGACGTCTCATGACTTTAATAATGGAGATACCTGGAGGCAGAAATTAACATT 239 **** ** * * * * *** * ** HPeV1 TCCAAAACAAGGTCATGGGTCCTTATCACTGTTGTTTGCTTATTTTACTGGTGAACTGAA 299 HPeV6 TCCATTTGAAGGTCATGGCTCTTTATCATTATTGTTTGCATATTTCACTGGAGAACTAAA 299 Consensus CCCAAAACAAGGTCATGGTTCACTTTCTCTGCTATTTGCTTATTTCACAGGTGAATTAAA 297 HPeV4 CCCAAAGAAAGGCCATGGTGCCTTAACCCAATTATTTGCCTATTACTCAGGAGAATTAAA 299 HPeV5 TCCCACACAGGGTCATGGTACTCTGACAAGACTCTTCACATATTACTCTGGTGAATTAAA 299 HPeV2 TCCAAAGGAAGGGCACGGTGCCCTATCACTTCTGTTTGCCTACTTTACTGGTGAATTAAA 299 HPeV7 CCCTAAGAAAGGCCATGGGATGCTATCACAACTTTTTGCATATTTTACGGGTGAAGTGAA 299 HPeV8 CCCAAAACAAGGCCACGGTGCACTTTCACAATTTTTTGCTTATTATACTGGAGAGTTAAA 299 HPeV3 TCCAAAAGAGGGTCATGGTATGTTATCACAGTTTTTTGCTTATTTTACAGGAGAAATAAA 299 ** * ** ** ** * * * ** * ** * * ** ** * ** HPeV1 TATCCATGTTCTGTTCCTAAGTGAGAGGGGGTTTCTGAGGGTTGCACACACATATGACAC 359 HPeV6 TATACATGTTCTATTCTTGTCAGGCAAAGGCTTTTTGAGGGTTGTACACACTTATGACAC 359 Consensus CATCCATGTTTTGTTCTTAGCTGGAAAAGGATTTCTTAGAGTAGCTCATACATATGACAC 357 HPeV4 TATACATGTTTTATTCTTGAGTGAAACAGGGTTTCTGAGAGTGGCACATACTTATGACAG 359 HPeV5 TGTGCATGTACTGTATCTTAGTGACAATGGGTTCCTCCGAGTAACTCATGCCTATGACCA 359 HPeV2 CATCCATGTTCTATTTCTTAGTGATAGGGGTTTTCTCAGAGTTGGACATACATATGACAC 359 HPeV7 TATACATATCCTTTATATGGCTGAAAGAGGATTTCTTAGAGTGGCACACTCATATGACAC 359 HPeV8 TATCCATGTACTGTTTTTGTGTGAAAAAGGTTTTCTCAGAGTAGCTCACACATATGACAG 359 HPeV3 TATTCATATCCTATATATGGCAAAGCAGGGGTTCCTTAGAGTGGCTCATACATATGACAC 359 * *** * * * * ** ** * * ** ** * ****** HPeV1 TAGTAATGATCGAGTCAATTTTCTGTCATCGAACGGTGTAATAACTGTACCAGCCGGAGA 419 HPeV6 TGCTGATAATAGATTAACTAACTTGGCCTCTAATGGCGTGATCACCATACCAGCTGGAGA 419 Consensus ATCAGAAAATAGAGTTAACTTCTTGTCATCTAATGGTGTTATCACAATCCCAGCGGGAGA 417 HPeV4 TGATACAAACAGGTCTGACTTCTTCTCTTCAAACGGCGTCATCACTGTGCCCGCAGGGGA 419 HPeV5 TGATAATGACAGATCCAACTTTTTGTCATCCAATGGAGTAATTACAGTGCCAGCAGGTGA 419 HPeV2 TGAGACAAACAGAACCAATTTTTTATCATCCAGTGGCATAATTACAGTACCAGCAGGAGA 419 HPeV7 TGAGACACAGAGGGATGACTTTCTATCATCAAATGGTGTGATAACAATACCAGCTGGAGA 419 HPeV8 TGATGAGGGGCGAGATGACTTCTTGTCATCCAATGGAGTCATTACCATACCAGCTGGAGA 419 HPeV3 TGAAGATAATAGGAAAACTTTCTTGTCTTCAAATGGGGTAATAACTATCCCTGCTGGTGA 419 * * * ** * ** * ** ** * ** ** ** ** HPeV1 GCAGATGACACTTTCAGCTCCCTACTATTCAAACAAACCATTAAGAACTGTCAGAGATAA 479 HPeV6 ACAAATGTCATTATCAGCCCCTTTCTATTCTCACAAGCCATTGAGGACGGTTAGGGACAC 479 Consensus ACAAATGACATTATCTGCACCTTACTACTCAAATAAACCCCTTAGGACAGTTAGGGACAG 477 HPeV4 ACAAATGACCCTGTCAGTACCATTCTACTCTTCAAAGCCCTTGAGGACAATCAGGGATTC 479 HPeV5 ACAGATGACGCTTTCTGTGCCATTCTATTCTTCTAAACCACTTAGAACAATAAGAGAAAC 479 HPeV2 ACAGATGACACTATCTGTCCCCTCTTATTCCAACAAGCCATTACGGACAGTTAGATCATC 479 HPeV7 ACAAATGACTTTATCTGTACCATACTACTCAAATAAACCATTGAGGACTATAAGACATGA 479 HPeV8 GCAAATGTCTCTATCTGCTCCATTCTACTCACACAGGCCATTGAGAACAATTCGCAATGA 479 HPeV3 GCAGATGACACTCTCAGTACCTTTTTATTCAAACAAGCCTCTGAGGACAGTGCGCCATGA 479 ** *** * * ** * ** * ** ** * ** * * ** * * HPeV1 CAATAGTCTTGGTTATTTGATGTGCAAGCCCTTCTTGACTGGAACCTCTACTGGTAAAAT 539 HPeV6 TCACAGCTTGGGTAGGCTTATTTGCAAACCATTCCTGACTGGAACAACATCTGGCAGGAT 539 Consensus CAATAGTCTTGGGTATCTGATGTGCAAGCCATTCCTCACTGGAACAACAACAGGGAAAAT 537 HPeV4 AGCTGCTCTAGGGTATGTGATGTGTAAACCATTCATGTCTGGGACAACAGGTGGAAAGAT 539 HPeV5 TGGTGCATTAGGCAAATTAATCTGTAAACCATTGTTGTCTGGCACACATTCAGGGAAGAT 539 HPeV2 CAATGCTTTAGGTTATTTACTGTGTAAACCATTGCTAACTGGTACCAGCTCTGGTAGAAT 539 HPeV7 ATCAGCACTTGGTTTCTTGTTGTGTCAACCACTTTTATCAGGTACAGACAGGACTATTGC 539 HPeV8 GGATGCATTAGGATATTTACTATGTCAACCTATGCTTACAGGAACATCAAGTGGCAAGAT 539 HPeV3 TTCAGCATTAGGTTTTCTTATGTGTAGACCATCGATGCACGGGACTACACGAACTACTGT 539 * ** * * ** ** * ** ** * HPeV1 TGAGGTTTATCTTAGCCTGAGATGTCCAAATTTCTTTTTCCCTCTTCCTGCCCCTAAGGT 599 HPeV6 AGAAGTATATATGAGTCTCAGGTGCCCAAATTTCTTCTTTCCTGTTCCAGCACCAAAAAA 599 Consensus AGAGGTCTACCTTAGCCTGAGGTGTCCAAATTTCTTCTTTCCTCTCCCCGCGCCTAAAGT 597 HPeV4 AGAGATATATCTGAGTTTAAGATGTCCAAACCTATTCTTTCCCTTACCAGCTCCGAAACC 599 HPeV5 CGAAGTTTATTTGAGTCTCAGATGCCCTAATCTATTCTTTCCTTCTCCTGCACCTAAAGA 599 HPeV2 AGAGATATTCCTTAGCTTGAGATGTCCAAATTTCTTCTTTCCCTTACCAGCACCAAAACC 599 HPeV7 AGAAGTATATATTAGCTTAAGGTGTCCAAACTTTTTCTTTCCAGCGCCAGCACCTAGACC 599 HPeV8 TGAGGTGTATCTCAGCTTGAGGTGTCCAAATCTGTTTTTTCCAATCCCAGCACCTAAGCC 599 HPeV3 AGAAGTTTATGTTAGTTTAAGGTGCCCCAATTTCTTTTTCCCTGTACCAGCTCCTAAACC 599 ** * * * ** * ** ** ** ** * ** ** ** ** ** ** * HPeV1 TAC -G -AGTAGTCGTGCACTACGGGGTGATATGGCAAACCTTACAAATCA 647 HPeV6 CACACCACGCTCG -CAAAGTCGTGCTCTACGAGGTGATATGGCTAATTTGACAAATCA 656 Consensus AAC -A -ACTGGTCGTACTTTGCGGGGTGACTTGGCAAATTTCTCAAACCA 645 HPeV4 TGC -A -ACTAGTCGTGCTTTGCGGGGTGACATGGCAAACTTCTCAGACCA 647 HPeV5 GAA -A -ACTTCCAGAGCTTTGCGGGGTGACTTGGCAAATTTTATAGATCA 647 HPeV2 AGC -AACACGTAAATATAGAGGAGATTTGGCAACATGGTCTGACCA 644 HPeV7 AATTAATACTACA -CCAATAGGC -TACAGTAACGAAAGCCCATATGGTCAAGAACA 653 HPeV8 TGCCAATGCATTAAGGTCACTCAACCCATTTAGTGATGAAAGTCCATATG -AAGCACC 656 HPeV3 AACTGGTTCAAGG GCTACAGCAC TTTCTGATGAG 633 ** HPeV1 G 648 HPeV6 G 657 Consensus HPeV4 G 648 HPeV5 G 648 HPeV2 A 645 HPeV7 AGTGACAAC 662 HPeV8 AAT 659 HPeV3 Discussion: I have started the experiment with an premise of HPeV virus infected the kid demoing mild diarrhea. The isolation of viral genome from the clinical sample utilizing Qiagen kit ( rule: selective binding belongingss of silicon oxide gel ) and Agarose gel cataphoresis proved that the viral genome was RNA. From analyzing the Agarose gel photographic image it clearly showed that the RNA isolation was successful ( Fig: 2 ) . From the gel photographic image of RT-PCR ( Fig:3 ) , we can presume that the PCR merchandise DNA is holding a molecular weight closer to that of 1018bp in the marker DNA. By plotting the graph between the molecular weight of DNA marker with the distance migrated in the gel ( Fig:4 ) , I could turn out the approximate molecular weight of DNA sample after PCR which is closer to the false value got from gel cataphoresis. The sequences which are complimentary to the primers used were selected as primer binding sites inorder to magnify under specific thermic rhythms. The absence of set in the negative control shows the RT- PCR done was right without any taint. The RT-PCR has helped to uncover speedy DNA elaboration which is advantageous over traditional PCR. It besides collects informations in the exponential growing stage whereas traditional PCR is measured at the terminal point. The cloning of PCR merchandise done utilizing pGEM R -T easy vectors which contain T7 and SP6 RNA polymerase boosters. A group of scientist under Smeekens.S.P has done their survey on T7 booster sequence. T7 RNA polymerase which has specific adhering belongingss with T7 boosters determines the reproduction of bacteriophage. The booster specific binding was shown to be insensitive to fluctuation in the ionic strength of incubation solution but found sensitive to DNA spiral. The efficiency of polymerase-promoter unfastened composites are determination factors of written text. ( Smeekens.S.P et.al ( 1986 ) Promoter and nonspecific DNA binding by T7 RNA polymerase, Oxford diary on Nucleic acids Research,14,2811-2827 ) The chief intent of utilizing the pGEM R -T easy vector is that, it is holding multiple cloning parts. It has ampicillin opposition cistron which would do the host cell to last in Principen rich medium. There are EcoR1 limitation enzyme acknowledgment sites on both sides of ligated RT-PCR merchandise in the vector. Thus the plasmid isolation after the Transformation is done utilizing EcoR1 enzymes. The enzyme DNA ligase ligated the RT-PCR merchandise into vector. The Deoxyribonucleic acid with the vector is transformed into competent E.coli cells. The inability of E.coli to accept DNA leads to do it competent utilizing CaCl2. If the whole procedure was successful we would hold got bluish and white settlements of cloned cells in the LB stock home bases. But the bluish settlements were non able to separate decently in the thick of other ampicillin sensitive settlements. The ground for the complete growing of unwanted settlements might be due to the low concentration of Ampicillin added as experimental mistake. Thus the Principen sensitive cells besides multiplied along with cells incorporating vector and cistron of involvement. As a consequence there was no set produced in the Agarose gel cataphoresis from the bluish settlement cells. The plasmid DNA isolated from the cloned cell was used for sequencing on both orientations without the separation of fragment. The Deoxyribonucleic acid sequence is analysed utilizing the package plan. The finding of direct or indirect orientation of DNA sequence is done utilizing Blast nucleotide hunts. The T7 belonged to human parechovirus1 ( length7380 ) was direct orientation with +/+ strand while SP6 belonged to human parechovirus1 ( length 7380 ) was found to be indirect with +/- strands. The contrary compliment for SP6 was taken and the alliance done utilizing Clustalw. Then with different HPeV type sequences the consensus sequences are compared utilizing Clustalw. By analyzing the sequences and phyletic tree the sequence isolated from clinical sample has similar hereditary beginning with HPeV1 type Parechovirus. Hence it is identified that the kid is infected with Parechovirus type1 infection. Recognition: I would wish to widen my sincere gratitude to Professor Glen Stanway, University of Essex, for his support and counsel for my practical work. I am besides widening my thanks to Ms. Maysoon, PhD pupil for her support during the practical work.

Thursday, November 21, 2019

TO WHAT EXTEND CAN FAMINE BE PREVENTED Essay Example | Topics and Well Written Essays - 1500 words

TO WHAT EXTEND CAN FAMINE BE PREVENTED - Essay Example Prevention of famine has been a major concern for both international organizations and academic institutions. Several strategies have been employed to counter famine and its effects throughout affected regions. Prevention of famine has always attracted the attention of various disciplines, with historians giving account of its occurrence in the past. Famine situations are complex and when it hits a region, the response can be daunting to the people and institutions involved. Various researchers have attempted to develop theoretical as well as comparative interdisciplinary approach to understanding the preventive measures. In order to understand the interlink ages between starvation, disease and starvation and death. Most researchers acknowledge that famine is preventable, compared against other issues such as poverty and food insecurity. This paper will look into the extent to which famine can be prevented and the strategies that can be used to fruitful. Extent to which Famine can be Prevented Famine has been attributed as a massive social failure, and should not be perceived merely as a natural tragedy. Stated differently, famine signals that institutions, organizations, governments and policies have failed. According to Dre?ze & Sen (1989), there should be people who are criminally liable to deaths of millions. Prevention, however, is essentially concerned with the protection of entitlements (Fine, 1997) Most institutions and governments develop policies and programs that minimize the impacts of famines. The most important though should be those that lay enough groundwork for future development. The policies should ensure both famine prevention and long-term food security assurances. The policies must promote and enhance agricultural growth, especially among small-scale farmers. In addition, infrastructural development should take centre stage in the global efforts to combat famine. Environmental rehabilitation programs and effective markets should be develop ed in the fight against famine alleviation. More importantly, each political geographical region must develop capacity to design and implement proper food policies and programs at all levels. Widespread famines have ravaged Ireland, China, India, and the horn of Africa. Famine situations are very complex and to mitigate against them requires a great deal of human commitment across several institutions and individuals. This is often a regional, short-term extreme food shortage, thought of as caused by drought, ecological extinction, and a sometimes accompanied by conflicts. A number of factors including poverty, inequality, commerce that is not regulated, and insufficient food schemes often fuels famine. Malthusian theory predicts that food will grow at a much lower rate than the growth in population, which will put a strain on the existing stocks of food (Madeley, 2000). However, there are writers who have faulted this theory by asserting that modern technology can actually lead to food increasing by more than the proportional increase in population. Dre?ze & Sen (1990) who wondered why in world where certain regions produced food that is more than enough yet other regions experienced severe food situations noted this paradox. Environments are increasingly becoming with the movement of people in the form of rural to urban migration, catalysing

Wednesday, November 20, 2019

The slave trade in Latin America. Profit and human misery Research Paper

The slave trade in Latin America. Profit and human misery - Research Paper Example As early as the 15th century the Spanish were gaining a stranglehold on Mexico and the various tribal lands of Latin America. A series of conquistadors, essentially privateers, more adventurers than soldiers, struck out on their own to secure the spoils and riches of the new lands. Up to the 16th century activities in this part of world were predominantly exploratory treasure hunts. Standing in their way, however, were the multitude of sedentary and fierce nomadic indigenous tribes which had to be overcome if the land was to be subjugated. By 1502 the first shipload of Africans had been landed in Hispanola. By the time of the full conquest of Mexico in the 1520 and Peru in the 1530s, all the elements of the colonial system of Latin America were falling into place. In Mexico, farming and mining were underway. In Brazil, under the Portuguese, the initial period of some coexistence through bartering and trade with the Indians was morphing into formal Spanish and Portuguese royal control .1 Along with it came the beginnings of a plantation economy. On the main land, as in the Caribbean, indigenous resistance and subsequent depopulation was spreading throughout Latin America, and by 1570 war and disease had taken its toll. Traditional sources of free labor diminished, and within thirty years of the Spanish landing tribes had been decimated. Along with depopulation and the emerging economy came the recognition that a large labor force would be needed to work the mines, ranches and sugar plantations cropping up like seedlings throughout Latin America.... rld, the need for slaves expanded, prompting the Portuguese traders to explore new markets for their â€Å"product.† Within thirty years of Columbus’s discovery, the Portuguese, beginning in Brazil, tapped into the growing market and before long were supplying an unending cache of slave workers for a burgeoning sugar industry. Assessing the northeastern coast of Brazil as particularly adopted to sugar growth, they began importing thousands of African slaves to that area, each of which was â€Å"not a mere captive but a commodity†¦ an investment†¦[that]†¦ impelled a vast expansion of the American sugar dominions. 2—an expansion that would eventually evolve as a lucrative commercial enterprise over the next three centuries via numerous other European slave traders. Estimates say that â€Å"By 1700 nearly three-quarters of the population of the British West Indies was African.† 3 Many countries including the French, Dutch and British eventuall y became prominent in the slave trade. The details of the actual practice seem today stunningly inhumane. And least it be forgotten, the truth remains that â€Å"The slave trade [its practices] was so awful in itself that one is apt to forget that it was merely a means to an end.† 4 That end was profit. Life on the Slave Ship Numerous accounts exist of the misery, suffering and dehumanizing environment of the slave ship that defy all modern sense of morality â€Å"as a brutally efficient piece of technology and site of struggle.† 5 All of the Europeans—Portuguese, Spanish, Dutch, British, French and Italians--freighted ships laden with barter to trade with Africans for African slaves. To those slave traders 16th through the 18th century, practices that would now be condemned universally as nothing short of â€Å"deliberately concealed

Monday, November 18, 2019

How would you describe your views on sex and sexuality Essay

How would you describe your views on sex and sexuality - Essay Example The essay "How would you describe your views on sex and sexuality" focuses on the view on sexuality and sex. In American culture, sex is not necessarily to be showed to a loved one, but can be merely a way to satisfy one's physical desires. However, I do not believe that sex can merely be used to fulfill a physical desire, like scratching an itch. The practice of sex outside the realms of marriage is considered to be a sin. Sex should be an emotional experience between loving, married couples and not between two compatible physical partners to show lust. Even if one grows up and experiences a want to be sexually content, the individual should wait for the right time to get married to fulfill his needs. Here I would like to state that when it comes to such activities the most important role is played by the society. If one is raised up in a conservative environment where such activities are considered a taboo before marriage then there are good chances that an individual will wait unt il marriage. Some societies, or basically the environment, in which people are raised do not allow any individual to stay with the opposite gender alone after they’ve reached puberty in order to keep distance and to maintain purity. This is a part of my culture and hence my belief. Hence, there is no way to explore the opposite gender and safe distance was maintained. These values are majorly uprooting from the religious and culture benchmarks one belongs to. Some sects believe that sexuality is only feasible after marriage.... At times being involved in sexual activities is considered to be a source of pride and manhood for the family and tribe. Moreover, Islam promotes sexuality after marriage and I side up with this view as a sexual relationship before marriage can lead to pregnancy and hence the birth of an illegitimate child. These days a fairly different concept has emerged with the increase in gays, lesbians and homosexuals. Today where freedom is given to each and every individual hence their sexual preference is also accepted. I personally would put forward that this act is going against nature and would never help to build up a normal life with normal children. One thing that needs to be highlighted here is that one cannot force another person to involve in sexuality without their consent. Strict laws are formulated throughout the world that deals with people who force, violate the dignity of another or involve in sexual activities with minors. In American culture Sex initially was considered to b e a sin and nobody on the front foot had the courage to be involved in such an activity but nowadays values have virtually died and one feels proud to call himself a 'non virgin'. Furthermore there is immense social pressure that has resulted in the widespread of sex related activities as those who do not follow the trend of exploitation are considered to be inhuman or incapable. (Teens and sex 2013) On the other hand the Middle Eastern culture still promotes chastity as they believe that a normal life cannot be lead without purity. Initially sex within marriage is to the process of reproduction and the purpose to initiate a family and enjoy the life, but sex outside the circle of marriage has become a trend and

Saturday, November 16, 2019

Automatic Quantification of the Myocardial Extracellular

Automatic Quantification of the Myocardial Extracellular Automatic Quantification of the Myocardial Extracellular Volume by  Cardiac Computed Tomography: Synthetic ECV by CCT Thomas A Treibel, MBBS1,2, Marianna Fontana, PhD,1,2, Jennifer A Steeden PhD2,3, Arthur Nasis, MD1, Jason Yeung, MBBS4, Steven K White, BSc, MBChB1,2, Sri Sivarajan4, Shonit Punwani, PhD4, Francesca Pugliese, PhD1, Stuart A Taylor, MD4, James C Moon, MD1,2, Steve Bandula, PhD4 1Barts Heart Centre, St Bartholomews Hospital, London, UK. 2Institute of Cardiovascular Science, University College London, London, UK. 3UCL Centre for Medical Image Computing, Department of Medical Physics, London, UK. 4Centre for Medical Imaging, University College London, London, UK. Manuscript Type: Original Manuscript Manuscript: 3924 words (all including) No conflict of interest declared. Funding: TAT and SB are supported by Doctoral Research Fellowships from the NIHR, UK (NIHR ­DRF ­ 2013-06-102 / NIHR ­DRF ­ 2011 ­04 ­008). MF and SKW are supported by Clinical Research Training Fellowships from the British Heart Foundation (grants FS/12/ 56/29723 and FS/10/72/28568). JCM is directly and indirectly supported by the University College London Hospitals NIHR Biomedical Research Centre and Biomedical Research Unit at Barts Hospital, respectively. FP: this work form part of the translational portfolio of the Cardiovascular Biomedical Research Unit at Barts, which is supported and funded by the NIHR. SAT is an NIHR senior investigator. This work was undertaken at University College London Hospital, which received a proportion of funding from the UK Department of Health National Institute for Health Research Biomedical Research Centres funding scheme. ABSTRACT [TT1] Background: The quantification of myocardial extracellular volume fraction (ECV) by Cardiac Computed Tomography (CCT) can identify changes in the extracellular space due to fibrosis or infiltration. Current methodologies require laboratory blood hematocrit (Hct) measurement which complicates the technique.   The attenuation of blood (HUblood) is known to change with anemia. We hypothesized that the relationship between Hct and HUblood could be calibrated to rapidly generate a synthetic ECV without the need to formally measure Hct. Methods: This retrospective study received institutional review board approval. The association between Hct and HUblood was derived from forty non-contrast thoracic CT scans using regression analysis. Synthetic Hct was then used to calculate synthetic ECV, and in turn compared with ECV using blood Hct in a validation cohort with mild interstitial expansion due to fibrosis (aortic stenosis, n=28, ECVCT = 28 ±4%) and severe interstitial expansion due to amyloidosis (n=27; ECVCT = 54 ±11%, psynthetic ECV was correlated with collagen volume fraction (CVF) in a separate cohort with aortic stenosis (n=18). All CT scans were performed at 120kV and 160 mAs. Results: HUblood was a good predictor of Hct (R2=0.47; p), with the regression model (Hct = [0.51 * HUblood] + 17.4) describing the association. Synthetic ECV correlated well with conventional ECV (R2=0.96; p with minimal bias and 2SD difference of 5.7%. Synthetic ECV correlated as well as conventional ECV with histological CVF (both R2=0.50, p). Finally, we implemented an automatic ECV plug-in for offline analysis. Conclusion: Synthetic ECV by CCT provides instantaneous quantification of the myocardial extracellular space without the need for blood sampling. KEYWORDS: Computed tomography; Myocardial tissue characterization; Extracellular matrix; Myocardial extracellular volume fraction; Myocardial fibrosis; cardiac amyloidosis. LIST OF ABBREVIATIONS AL amyloidosis = Immunoglobulin light-chain amyloidosis AS = Aortic stenosis CCT = Cardiac computed tomography CMR = Cardiovascular magnetic resonance CVF = Collagen volume fraction ECV = Extracellular volume fraction HU = Hounsfield units INTRODUCTION Extracellular volume fraction (ECV) quantification by cardiac computed tomography (CCT) 1-5 and cardiovascular magnetic resonance (CMR) 6, 7 is a promising new imaging biomarker for interstitial expansion due to myocardial fibrosis and cardiac amyloid deposition. Emerging data suggests ECV predicts outcome as well as left ventricular ejection fraction 8, 9 and there is increasing interest in targeting the interstitium during the development of heart failure therapy.10 Current methodologies for ECV quantification require blood hematocrit (Hct) measurement, which adds a layer of complexity and is potentially a barrier to easy clinical implementation. Alternatively, for CMR, Treibel et al. recently proposed a synthetic ECV technique, removing the need for Hct measurement by utilizing the relationship between relaxivity of blood and lab measured Hct.11 It is unknown if a similar approach can be used for CCT, although a relationship between anemia and unenhanced blood attenuation has been observed.12-17 For example the aortic ring sign and dense intra-ventricular septum on unenhanced thoracic CTs suggest underlying anemia.17-19 We hypothesized that the relationship between Hct and unenhanced blood attenuation (HUblood) could be used to estimate a synthetic Hct, permitting immediate synthetic ECV calculation without blood sampling. We used existing patient cohorts1, 4 to investigate how synthetic ECV (a) compares to conventional ECV, and (b) correlates with the reference standard collagen volume fraction. We also tested implementation of an automated synthetic ECV measurement plug-in within the open-source DICOM viewer OsiriX.20 MATERIAL AND METHODS This study is a retrospective analysis of prospectively acquired data, received local ethical approval and conformed to the principles of the Helsinki Declaration. The study received no industry support.   All participants provided informed and written consent. Exclusion criteria were uncontrolled arrhythmia or impaired renal function (estimated glomerular filtration rate ECV CCT Protocols. The CCT protocol consisted of three steps: first, a low dose non-contrast scan to obtain baseline attenuations; second, contrast administration with a contrast-enhanced 1-minute acquisition and a 5 minute delay to allow blood to myocardial contrast equilibration; third, a repeat scan to re-measure blood and myocardial attenuations. CCT examinations were performed on a 64-detector row CT scanner (Somatom Sensation 64; Siemens Medical Solutions, Germany).1, 4 A topogram was used to plan CT volumes from the level of the aortic valve to the inferior aspect of the heart, typically a 10 cm slab. Cardiac scans (tube voltage, 120 kV; tube current-time product, 160 mAs; section collimation, 64 detector rows, 1.2-mm section thickness; gantry rotation time, 330 msec) were acquired with prospective gating (65%-75% of R-R interval), and reconstructed into 3-mm-thick axial sections with a B20f kernel. All pre- and post contrast acquisitions were performed and reconstructed with the same parameters and matched the level of the pre-contrast scan. The iodinated contrast material used was iohexol (Omnipaque 300; Nycomed Amersham, Oslo, Norway; 300 mg of iodine per milliliter) at a standard dose of 1mL/kg and injection rate of 3ml/sec without a saline chaser. Image Analysis. CCT image analysis was performed using a free and open-source Digital Imaging and Communications in Medicine viewer (OsiriX v4.1.2; Pixmeo, Bernex, Switzerland) independently by two experienced readers blinded to all other study data. For Hct estimation, regions of interest (ROIs) were placed in in a single axial slice in the center of the right atrium. The mean area of these ROIs were 4.8 ±1.2cm2. ROIs were drawn in the myocardial left ventricular septum and blood pool in the contrast-enhanced 1-minute acquisition in axial sections and propagated to the pre-contrast and post contrast acquisitions. Myocardial and blood attenuation values (pre-and post contrast only) were used to calculate the ECV fraction from the ratio of the change in blood and myocardial attenuation (ΆHU) corrected by the blood volume of distribution (1 Hematocrit): ECV   =   (1 Hematocrit) x (ΆHUtissue / ΆHUblood) Synthetic Hematocrit and ECV Methodology 1. Derivation of synthetic Hematocrit To derive a regression model predicting hematocrit from pre-contrast HUblood, clinical unenhanced CT scans of the thorax were retrospectively analyzed (120 kV; reconstructed at 5mm slice thickness and B70F soft tissue kernel). These were consecutive clinical CT scans of the thorax for investigation of malignancy, fibrosis or infection. Datasets were included if the patients had a contemporaneous paired laboratory measured Hct (within 20 days, median 8 days). HUblood was analyzed in a single axial slice through the center of the right atrium. This was chosen to minimize beam-hardening artifact from the spine (compared to aortic blood pool) and partial voluming of papillary muscles in the left or right ventricular blood pool. Synthetic Hct was obtained from the equation describing the linear regression line between laboratory HUblood and Hct. 2. Creation of a synthetic ECV Equation Blood hematocrit was substituted by the derived synthetic Hct to derive a synthetic ECV: Synthetic ECV   =   (1 synthetic Hct) x (ΆHUtissue / ΆHUblood) 3. Validation of synthetic ECV For validation, we used existing patient cohorts to investigate how synthetic ECV (a) compares to conventional ECV with laboratory blood hematocrit,4 and (b) correlates with the reference standard collagen volume fraction.1 3a. Clinical Validation Cohort In order to test synthetic ECV across a range of ECV values, the cohort used by our group to validate ECV by CT in amyloidosis was chosen; this comprised of two sub-groups with differing degrees of extracellular volume expansion: I. patients with cardiac amyloidosis (typically high ECV), comprising of 26 patients with systemic amyloidosis (21 males, age 55 ±10 years; 18 with transthyretin amyloidosis; 8 with systemic AL amyloidosis) with varying degrees of cardiac involvement; II. A comparator group of 27 age- and sex-matched patients with severe aortic stenosis (19 male, age 68 ±8 years) who typically exhibit only mild ECV elevation. Scans were performed between January and December 2013. In the clinical cohort, contrast administration was performed using a bolus only approach with a 1 mL/kg bolus of iohexol and post-contrast imaging at 1 minute (for segmentation) and 5 minutes (for post contrast analysis), as validated by our group previously.4 3b. Histological Validation Cohort For histological validation, the performance of synthetic ECV against a histological measure of fibrosis, the collagen volume fraction (CVF), was tested in a second smaller cohort of patients with severe AS, who underwent intra-operative biopsy (no overlap with clinical cohort). This cohort had been used by our group to validate ECV by CT again histology:1 Consenting severe AS patients (n = 17, median age 71 ±10 years, 76% male) underwent CCT between July 2010 and February 2012. Biopsies were obtained and stained with picrosirius red for histological measurement of collagen volume fraction (CVF) as previously described.21 In the histology cohort, contrast administration followed primed iodinated contrast material infusion (bolus plus maintenance infusion) with a 1 mL/kg bolus of iohexol followed by a maintenance infusion of at a rate of 1.88 mL/kg per hour for 25 minutes, when the post contrast imaging was performed.1 4. OsiriX Plugin To facilitate offline analysis and to exemplify future inline automation by scanner manufacturers, an automatic synthetic ECV plug-in was developed for OsiriX. Statistical analysis Analyses were performed using SPSS (Chicago, IL, USA, version 22). All data are presented as mean  ± SD. Normal distribution was assessed by using the Kolmogorov-Smirnov test. Differences were assessed using unpaired, two-sided student t-tests (significance level p). Agreement between conventional and synthetic ECV was analyzed using the Bland-Altman method. The significance of the difference between two correlation coefficients was tested using the Fisher r-to-z transformation. RESULTS[TT2] Step 1. Derivation cohort 40 thoracic CT scans with contemporaneous Hct samples within 20 days (mean 8 ±7 days) of the scan were included (n=40, 53% male, age 60 ±20 years) with a broad range of Hct (mean 38.2 ±6.0%; range 24.7-50.7%) and HUblood (mean 40 ±8; range 20-55). The linear regression equation was:   (sHct = [0.51 * HUblood] + 17.4) with R2=0.47 p (Figure 1). Step 2. Creation of the synthetic ECV Equation Blood hematocrit was substituted by the derived synthetic Hct to derive a synthetic ECV: Synthetic ECV   =   (1 ([0.51 * HUblood] + 17.4)x (ΆHUtissue / ΆHUblood) Step 3. Validation Step 3a. Clinical cohort Baseline characteristics of twenty-six systemic amyloidosis and twenty-seven AS patients are shown in Table 1.In this cohort, Hct were mean 41.4 ±3.8% (range 29.3-47.4%) and HUblood mean 40.2 ±3.9 (range 29.3-50.1). Synthetic ECV, calculated using the regression model to derive HCT,and conventional ECV were highly correlated (R2=0.96; p) with a 5.7% SD of differences and minimal bias (2.4%) on Bland-Altman analysis (Figure 2). ECVCT was significantly higher in amyloid patients with definitive cardiac involvement than aortic stenosis (54 ±11% versus 28 ±4%, p Step 3b. Histology cohort Baseline characteristics of the histology cohort are described in Table 2.The mean histological CVF of the 17 biopsies was 18  ± 8% (range 5% to 40%), Hct were 40.2 ±4.6% (range 29.4-46.4%) and HUblood 37.7 ±4.2 (range 29.5-45.1). Synthetic and conventional ECV both correlated well with collagen volume fraction (R2 = 0.50, p vs. R2 = 0.50, p ; Figure 3) and did not differ statistically on Fisher r-to-z transformation (p = 0.8). Step 4. Automatic synthetic ECV plug-in in OsiriX Example output of the OsiriX plugin are shown in Figure 4, and the code is provided in the supplementary data. This plugin involves three simple steps: I. Manual segmentation of the blood pool in the pre- and post-contrast images; II. The plug-in automatically estimates blood hematocrit using the attenuation relationship defined above; III. The plug-in produces a three-dimensional myocardial ECV volume, where each image voxel represents an ECV value. Reproducibility Inter- and intra-observer agreement was excellent for myocardial (ICC = 0.92 and ICC = 0.94, respectively) and blood pool (ICC = 0.96 and ICC = 0.99, respectively) attenuation measurements. Similarly for ECV, excellent agreement was found (ICC = 0.95 and ICC = 0.98, respectively). Repeat sampling variability was tested in 44 patients who underwent two samples a median of 4 hours apart. Test:retest variability of laboratory hematocrit was higher than expected (n=44, variability 10% with hct:hct R2=0.86.11 DISCUSSION Identifying interstitial heart disease is important for diagnosis and prognosis,10 and myocardial extracellular volume fraction (ECV) can be measured non-invasively by CCT.1-4 However, its measurement is complicated by the necessity for venous blood sampling, image analysis and then offline ECV calculation. This process is cumbersome and a major obstacle for implementing this technique into routine clinical practice. In this manuscript, we simplify the technique by calculating ECV without blood hematocrit. This development arose out of a need to simplify ECV measurement to make it more clinically applicable. We utilize the relationship between hematocrit and blood attenuation (the attenuation of blood decreases with anemia)12-14, 17-19 to derive a synthetic hematocrit for immediate synthetic ECV calculation without blood sampling. We show that synthetic ECV was highly correlated to conventional ECV, and had a similar association to the histologic reference standard of CVF. The implementation of an offline automated processing tool provides a significant aid to workflow, allowing for ECV measurement in routine clinical practice.   Automated synthetic ECV can be implemented inline on CT scanners with test performances approaching that of conventional ECV measurement. ECV quantification by CT, despite it lower signal to noise ratio, has key advantage over CMR: The CT approach is cheaper and widely available, can be completed in 5 minutes, and the scanner design can accommodate patients with obesity and claustrophobia (CMR is not suitable in around 10% of patients due to claustrophobia or many cardiac pacemakers).22 Furthermore, ECV by CCT can provide high-resolution 3D ECV volumes with whole heart acquisition and limited cardiac motion. Finally, the concentration of iodine has a linear relationship with th e CT attenuation value, which is not affected by fast exchange mechanism like CMR T1 mapping (depending on cell size and contrast dose, fast transcytolemmal water-exchange may reach its limits), which do not apply to CT.23, 24 ECV (by CMR or CT) allows quantification of a key pathophysiological pathway in heart failure: interstitial expansion due to diffuse myocardial fibrosis (or in rare cases by deposition of amyloid fibrils).1-4 As the CMR field is showing, ECV is diagnostic in certain diseases, tracks myocardial remodelling and predicts outcome.25, 26 Interstitial expansion can be global (hypertension, aortic stenosis) or focal (hypertrophic or dilated cardiomyopathy), therefore high spatial resolution and whole heart coverage is important. Due to the aforementioned advantages of CT over CMR, ECV by CT will undoubtedly receive greater attention as part of comprehensive assessment of the heart by CT coronary angiography, perfusion and myocardial tissue characterization. Limitations[TT3] The study has limitations. In the derivation cohort, the mean interval between Hct samples and CT 8 days. Normal within-subject variation in Hct between 1 day and 1-2 months in a healthy adult is actually very low (3%), but together with an analytical variation (3%) this may explain a relative change of >10% between two successive Hct values.27 The control cohort used in this study comprised of patients with AS rather then healthy volunteers, but, given the exposure to ionizing radiation and contrast, patients with AS were deemed as adequate control cohort, avoiding exposure of healthy volunteers. For the same reasons, variability of repeat synthetic ECV was not tested. Development and validation were performed using a single scanner platform, therefore this regression model is only valid for 120 kV and an X-ray tube used in a specific CT vendor. Spectrum of the X-rays emitted by a CT X-ray tube substantially varies among CT vendors. In addition, low KV scans are increasingly used to reduce radiation exposure to the patients. Consequently, multiple regression models for different KV settings as well as for different CT vendors should be carefully prepared for synthetic ECV by CCT. Other factors that may affect the attenuation of blood such as temperature28 and other blood constituents such as macromolecules, fat and iron require further investigation. The 64-slice-CT-system employed here reflects commonly available systems, but did not offer iterative reconstruction algorithms, dual energy acquisition and larger detector arrays that allow acquisition of whole heart, isotropic volumes of in one heart beat and at low radiation dose. In single-source 64 detector rows CT, myocardial CT attenuation is not homogenous due to artifacts, especially in the inferior wall and lateral wall. In the current study, we only included data from ROIs in the left ventricular septum. The accuracy of synthetic ECV should be validated in other segments in LV myocardium, if synthetic ECV by CT is more widely available and used in patients. Furthermore, 3D image registration and processing, reduces the errors of whole heart ECV maps.29 CONCLUSION Synthetic hematocrit derived from the relationship between blood hematocrit and blood attenuation allows quantification of the myocardial extracellular volume fraction by cardiac computed tomography without the need for blood sampling. ECV shows great potential, allowing myocardial tissue characterization with negligible effect on workflow and radiation dose. However wider adoption requires simplification and automation of the established technique synthetic ECV offers this. REFERENCES 1.Bandula S, White SK, Flett AS, et al. Measurement of myocardial extracellular volume fraction by using equilibrium contrast-enhanced CT: validation against histologic findings. Radiology. 2013;269:396-403. 2.Nacif MS, Kawel N, Lee JJ, et al. Interstitial myocardial fibrosis assessed as extracellular volume fraction with low-radiation-dose cardiac CT. Radiology. 2012;264:876-883. 3.Nacif MS, Liu Y, Yao J, et al. 3D left ventricular extracellular volume fraction by low-radiation dose cardiac CT: assessment of interstitial myocardial fibrosis. J Cardiovasc Comput Tomogr. 2013;7:51-57. 4.Treibel TA, Bandula S, Fontana M, et al. Extracellular volume quantification by dynamic equilibrium cardiac computed tomography in cardiac amyloidosis. J Cardiovasc Comput Tomogr. 2015. 5.Kurita Y, Kitagawa K, Kurobe Y, et al. Estimation of myocardial extracellular volume fraction with cardiac CT in subjects without clinical coronary artery disease: A feasibility study. J Cardiovasc Comput Tomogr. 2016;10:237-241. 6.Ugander M, Oki AJ, Hsu LY, et al. Extracellular volume imaging by magnetic resonance imaging provides insights into overt and sub-clinical myocardial pathology. Eur Heart J. 2012;33:1268-1278. 7.Banypersad SM, Fontana M, Maestrini V, et al. T1 mapping and survival in systemic light-chain amyloidosis. Eur Heart J. 2015;36:244-251. 8.Wong TC, Piehler K, Meier CG, et al. Association Between Extracellular Matrix Expansion Quantified by Cardiovascular Magnetic Resonance and Short-Term Mortality. Circulation. 2012;126:1206-1216. 9.Wong TC, Piehler KM, Kang IA, et al. Myocardial extracellular volume fraction quantified by cardiovascular magnetic resonance is increased in diabetes and associated with mortality and incident heart failure admission. Eur Heart J. 2014;35:657-664. 10.Schelbert EB, Fonarow GC, Bonow RO, Butler J, Gheorghiade M. Therapeutic targets in heart failure: refocusing on the myocardial interstitium. J Am Coll Cardiol. 2014;63:2188-2198. 11.Moon JC, Treibel TA, Schelbert EB. T1 mapping for diffuse myocardial fibrosis: a key biomarker in cardiac disease? Journal of the American College of Cardiology. 2013;62:1288-1289. 12.New PF, Aronow S. Attenuation measurements of whole blood and blood fractions in computed tomography. Radiology. 1976;121:635-640. 13.Black DF, Rad AE, Gray LA, Campeau NG, Kallmes DF. Cerebral venous sinus density on noncontrast CT correlates with hematocrit. AJNR. American journal of neuroradiology. 2011;32:1354-1357. 14.Collins AJ, Gillespie S, Kelly BE. Can computed tomography identify patients with anaemia? The Ulster medical journal. 2001;70:116-118. 15.Lan H, Nishihara S, Nishitani H. Accuracy of computed tomography attenuation measurements for diagnosing anemia. Jpn J Radiol. 2010;28:53-57. 16.Jung C, Groth M, Bley TA, et al. Assessment of anemia during CT pulmonary angiography. Eur J Radiol. 2012;81:4196-4202. 17.Kamel EM, Rizzo E, Duchosal MA, et al. Radiological profile of anemia on unenhanced MDCT of the thorax. Eur Radiol. 2008;18:1863-1868. 18.Wojtowicz J, Rzymski K, Czarnecki R. Severe anaemia: its CT findings in the cardiovascular system. Eur J Radiol. 1983;3:108-111. 19.Doppman JL, Rienmuller R, Lissner J. The visualized interventricular septum on cardiac computed tomography: a clue to the presence of severe anemia. Journal of computer assisted tomography. 1981;5:157-160. 20.Jalbert F, Paoli JR. [Osirix: free and open-source software for medical imagery]. Revue de stomatologie et de chirurgie maxillo-faciale. 2008;109:53-55. 21.Flett AS, Flett AS, Hayward MP, et al. Equilibrium contrast cardiovascular magnetic resonance for the measurement of diffuse myocardial fibrosis: preliminary validation in humans. Circulation. 2010;122:138-144. 22.Rosmini S, Treibel TA, Bandula S, et al. Cardiac computed tomography for the detection of cardiac amyloidosis. J Cardiovasc Comput Tomogr. 2016. 23.Moon JC, Messroghli DR, Kellman P, et al. Myocardial T1 mapping and extracellular volume quantification: a Society for Cardiovascular Magnetic Resonance (SCMR) and CMR Working Group of the European Society of Cardiology consensus statement. J Cardiovasc Magn Reson. 2013;15:92. 24.Coelho-Filho OR, Holland DJ, Mongeon FP, et al. Role of Transcytolemmal Water-Exchange in Magnetic Resonance Measurements of Diffuse Myocardial Fibrosis in Hypertensive Heart Disease. Circulation. Cardiovascular imaging. 2013;6:134-141. 25.Banypersad SM, Banypersad SM, Sado DM, et al. Quantification of Myocardial Extracellular Volume Fraction in Systemic AL Amyloidosis: An Equilibrium Contrast Cardiovascular Magnetic Resonance Study. Circulation. Cardiovascular imaging. 2013;6:34-39. 26.Wong TC, Wong TC, Piehler KM, et al. Myocardial extracellular volume fraction quantified by cardiovascular magnetic resonance is increased in diabetes and associated with mortality and incident heart failure admission. European Heart Journal. 2013. 27.Thirup P. Haematocrit: within-subject and seasonal variation. Sports Med. 2003;33:231-243. 28.Bydder GM, Kreel L. The temperature dependence of computed tomography attenuation values. Journal of computer assisted tomography. 1979;3:506-510. 29.Nacif MS, Liu Y, Yao J, et al. 3D left ventricular extracellular volume fraction by low-radiation dose cardiac CT: assessment of interstitial myocardial fibrosis. J Cardiovasc Comput Tomogr. 2013;7:51-57. FIGURES Figure 1: Derivation of synthetic hematocrit from the attenuation of blood Thoracic CT scans (n=40, 53% male, age 60 ±20 years) with contemporaneous hematocrit samples (mean interval 8.8 ±7.3 days) of the scan were used to create a regression line between hematocrit (Hct; 38.2 ±6.0%; range 24.7-50.7%) and blood attenuation (HUblood; 40.7 ±8.0; range 19.5-55.2). The regression line between Hct and HUblood was linear (R2=0.47 p) with a regression equation for synthetic Hct = [0.51 * HUblood] + 17.4). Figure 2: Validation of synthetic ECV vs conventional ECV in AS and Amyloid Synthetic ECV, calculated using the regression model,and conventional ECV were highly correlated (R2=0.96; p) with a 5.7% SD of differences and minimal bias (2.4%) on Bland-Altman analysis (right image). Figure 3: Histological Validation of Synthetic ECV Synthetic and conventional ECV both correlated well with collagen volume fraction (R2 = 0.50, p vs. R2 = 0.50, p ) and did not differ statistically. Figure 4: OsiriX Plugin workflow To facilitate offline analysis and allow future inline automation, an automatic synthetic ECV plug-in was developed for Osirix. Following manual segmentation of the blood pool in the pre- and post-contrast images, the plug-in automatically estimates blood hematocrit using the attenuation relationship defined above, and produces a three-dimensional myocardial ECV volume from pre- and post-contrast CCT data.

Wednesday, November 13, 2019

Success of Coke Essay -- Coca-Cola Essays

There are very few corporations that hold such world popularity like the Coca-Cola Company. The trademark of Coca-Cola is by far one of the world’s most popular brand names. Coca-Cola dominates the product industry and sets a standard of competition not easily met. Research shows that the trademark is recognized by over 94% of the world’s population and is the most widely recognized word following â€Å"OK.† Coke’s original formula was conceived in the late 19th Century. It original business began as a health formula with less than 10 servings a day in its first year. Now business is credited with approximately 1 billion servings consumed each day. Coca-Cola now holds a monopoly on the soft drink industry and includes a massive 500 product range. Coca-Cola led the first parts of early advertising endorsement, and as early as 1886 the company began promoting its product. From there it began the revolution of product advertisement that is now evident in every part of life. Coke is seen as one of the founding fathers for the present marketing competition that now infests modern living. It was an early pioneer of the styles used to capture an audience, and has continued its developments into product advertising. It was one of the first companies to offer a gimmick with it product, this being a small yo-yo. Throughout the era in 1886-2000 the product has been through a change a marketing plea. It was as early as 1904 that Coca-Cola began presenting the drink as a delicious and refreshing formula. This familiar slogan has been continually repeated for nearly 100 years selling Coke as a great Drink. There is certainly a factor that has added to Coca-Cola controlling such a monopoly of the soft drink industry. Whether that factor is its original and unique taste that has captured the world, or is it the cleverly designed advertisements that have captured the mind of today’s generations? In this essay I hope to express my opinions on why such a product has gained such world popularity. I hope to make you think twice before choosing your product and point out the strong role that advertising has placed in our generation. There is no doubt in my mind that most of Cokes, if not all of Cokes business is due to the clever marketing strategies that they have employed over the years. Over time coke has built an image, this image reflects what we think of when we bu... ...lds. Looking at the issue through my eyes, I have grown up with the knowledge that coke is its own individual product, not just individual brand. This idea has been programmed by the adverts that show coke being the one and only. These ads encourage both desire and action; they create a sense of urgency for the product, by showing Coke being drunk and loved by all. Coke, being one of the early pioneers of product advertisement has been able to create, shape and destroy the successful and unsuccessful forms of advertisement. This extensive and powerful knowledge, has allowed coke to change its marketing pleas through the eras. I believe this powerful knowledge has allowed coke to grow into the empire it is today. I believe it is not possible for one product to grow so popular due to its taste. The product would not have spread so rigorously throughout the world because of its taste only. Coke has been clever in its sponsoring of events which has allowed it massive amounts of advertising virtually unequal to any other product in the world today. I wonder whether any other company can ever be as successful as Coke or is Coke to far in front for any company to ever catch up!